90
|
Nucletron B V
micro-selectron hdr 192 ir v2 remote after-loader Micro Selectron Hdr 192 Ir V2 Remote After Loader, supplied by Nucletron B V, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/hdr+192+ir+source/pmc02674240-71-7-11 Average 90 stars, based on 1 article reviews
micro-selectron hdr 192 ir v2 remote after-loader - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
99
|
Vazyme Biotech Co
n411 deposited data raw data N411 Deposited Data Raw Data, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/VAHTS+DNA+Clean+Beads/pm32860752-217-45-43 Average 99 stars, based on 1 article reviews
n411 deposited data raw data - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
plenticrisprv2 crrna2: agctcattctgtatggtcgg Plenticrisprv2 Crrna2: Agctcattctgtatggtcgg, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/crrna2/pmc06224545__mmc2-251-157-190 Average 90 stars, based on 1 article reviews
plenticrisprv2 crrna2: agctcattctgtatggtcgg - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
plenticrisprv2 crrna3: gactcttacccgaatcacag Plenticrisprv2 Crrna3: Gactcttacccgaatcacag, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/plenticrisprv2+crrna3++gactcttacccgaatcacag/pmc06224545__mmc2-251-206-200 Average 90 stars, based on 1 article reviews
plenticrisprv2 crrna3: gactcttacccgaatcacag - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
European Collection of Authenticated Cell Cultures
a2780 A2780, supplied by European Collection of Authenticated Cell Cultures, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/a2780/pmc06224545__mmc2-251-53-61 Average 90 stars, based on 1 article reviews
a2780 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Dynabyte GmbH
multiplate analyzer, software version v2.03.11 Multiplate Analyzer, Software Version V2.03.11, supplied by Dynabyte GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/multiplate+analyzer++software+version+v2+03+11/pm28390056-51-25-40 Average 90 stars, based on 1 article reviews
multiplate analyzer, software version v2.03.11 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Vazyme Biotech Co
mut express multi fast mutagenesis kit v2 Mut Express Multi Fast Mutagenesis Kit V2, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/Mut+Express+MultiS+Fast+Mutagenesis+Kit+V2/pm36754175-83-19-26 Average 90 stars, based on 1 article reviews
mut express multi fast mutagenesis kit v2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Dynabyte GmbH
multiplate multichannel impedance aggregometer Multiplate Multichannel Impedance Aggregometer, supplied by Dynabyte GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/multiplate+platelet+function+analysis+v2+03+11/multiple+platelet+function+analyzer/pm28276730-33-30-34 Average 90 stars, based on 1 article reviews
multiplate multichannel impedance aggregometer - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |